Detail information of AT2G22430_circ_g.1


General Information
CircRNA Name AT2G22430_circ_g.1
ID in PlantcircBase ath_circ_014369
Alias NA
Organism Arabidpsis thaliana
Position chr2: 9526863-9526918  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method CIRI
Parent gene AT2G22430
Parent gene annotation Homeobox-leucine zipper protein ATHB-6
Parent gene strand -
Alternative splicing NA
Support reads 2
Tissues root
Exon boundary   No-No
Splicing signals   CT-AC
Number of exons covered AT2G22430.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GCGTTGTTCTCTTCTTCTTCTTCTTCTCcgaaatatcactctccgttgtcaccgcc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence CGAAATATCACTCTCCGTTGTCACCGCCGCGTTGTTCTCTTCTTCTTCTTCTTCTC
Conservation Information
Conserved circRNAs NA
PMCS 0.503204167
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017