Detail information of AT3G21805_circ_g.1


General Information
CircRNA Name AT3G21805_circ_g.1
ID in PlantcircBase ath_circ_023137
Alias NA
Organism Arabidpsis thaliana
Position chr3: 7682364-7682452  JBrowse»
Reference genome TAIR10.38
Type   ig-circRNA
Identification method PcircRNA_finder
Parent gene NA
Parent gene annotation NA
Parent gene strand NA
Alternative splicing NA
Support reads 2
Tissues aerial
Exon boundary   No-Yes
Splicing signals   AA-TA
Number of exons covered NA
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CTCTTCACCCAGAATTTGAAGAAACAACCCTTGGCTGTCTGAGTtggtgatgaaacgaatattt
cgtggactagagtttcagatctggg
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence TGGTGATGAAACGAATATTTCGTGGACTAGAGTTTCAGATCTGGGCTCTTCACCCAGAATTTGA
AGAAACAACCCTTGGCTGTCTGAGT
Conservation Information
Conserved circRNAs NA
PMCS 0.240793352
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017