logo





circRNA ID
AT1G01430_circ_g.1
Alias
ath_circ_000067, Ath_circ_FC0122
Organism
Arabidpsis thaliana
Position
chr1: 157829-158112  JBrowse»
Reference genome
TAIR10.38
Type  
e-circRNA
Identification method
CIRCexplorer, KNIFE, PcircRNA_finder, circRNA_finder, CIRI-full
Parent gene
Parent gene annotation
Protein trichome birefringence-like 25
Parent gene strand
-
Alternative splicing
NA
Splice junction sequence  
TTTTGGTAATCTTGGATATGACGGCAAGAGACATTGGTGTAGATTGGCCCTGATGGGTCTGGTA
CCCAATTCCCGATAAAGATATCACACTTGGTTGAAActgagagagaatgcagaggagggattgg
acatggttacgagagatggaatcaccgataaaagccaaccatttgttcctcatattgtcaagga
attgctca
Support reads
35
Tissues
whole_plant
Exon boundary  
Yes-Yes
Splicing signals  
CT-AC
Sanger sequencing for BSS  
NA
PCR primers for BSS  
NA
Assembled circRNA sequence  
CTGAGAGAGAATGCAGAGGAGGGATTGGACATGGTTACGAGAGATGGAATCACCGATAAAAGCC
AACCATTTGTTCCTCATATTGTCAAGGAATTGCTCAGGGTTAAACCTCGGGAGATCGCAATCGC
GAGGTTGCCATCTCCATCGAAGGTAATTCACATCTGGCCTTCCGTTTTTCAAGCAATTTTGGTA
ATCTTGGATATGACGGCAAGAGACATTGGTGTAGATTGGCCCTGATGGGTCTGGTACCCAATTC
CCGATAAAGATATCACACTTGGTTGAAA
Sanger sequencing for FL  
NA
PCR primers for FL  
NA
Genomic sequence
CTGAGAGAGAATGCAGAGGAGGGATTGGACATGGTTACGAGAGATGGAATCACCGATAAAAGCC
AACCATTTGTTCCTCATATTGTCAAGGAATTGCTCAGGGTTAAACCTCGGGAGATCGCAATCGC
GAGGTTGCCATCTCCATCGAAGGTAATTCACATCTGGCCTTCCGTTTTTCAAGCAATTTTGGTA
ATCTTGGATATGACGGCAAGAGACATTGGTGTAGATTGGCCCTGATGGGTCTGGTACCCAATTC
CCGATAAAGATATCACACTTGGTTGAAA
Number of exons covered
AT1G01430.1:1
Conserved circRNAs
NA
Coding potential
N
Potential coding position
NA
Potential amino acid sequence
NA
Sponge-miRNAs
NA
circRNA-miRNA-mRNA network
References
Chu et al., 2017;Chen et al., 2017

Copyright©2017-2021 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn
For submittion, please click here. Last modified at 2021-03-09.

Supported by   nsfc    zju