Detail information of Os07g0687900_circ_g.1


General Information
CircRNA Name Os07g0687900_circ_g.1
ID in PlantcircBase osa_circ_035403
Alias NA
Organism Oryza sativa
Position chr7: 29221003-29221047  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method circRNA_finder
Parent gene Os07g0687900
Parent gene annotation WSI76 protein induced by water stress. (Os07t0687900-01)
Parent gene strand -
Alternative splicing NA
Support reads 2
Tissues leaf
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered Os07t0687900-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AGAGCATGGCGAGAACGAGGTTgtcgacgttctccgggtgcctcc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTCGACGTTCTCCGGGTGCCTCCAGAGCATGGCGAGAACGAGGTT
Conservation Information
Conserved circRNAs NA
PMCS 0.312957037
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017