Detail information of AT3G26370_circ_g.3


General Information
CircRNA Name AT3G26370_circ_g.3
ID in PlantcircBase ath_circ_023890
Alias NA
Organism Arabidpsis thaliana
Position chr3: 9658666-9658805  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene AT3G26370
Parent gene annotation Protein PECTIC ARABINOGALACTAN SYNTHESIS-RELATED
Parent gene strand +
Alternative splicing AT3G26370_circ_g.2 AT3G26370_circ_g.4
Support reads 1
Tissues aerial
Exon boundary   No-No
Splicing signals   TA-GG
Number of exons covered AT3G26370.1:1
AT3G26370.2:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CAGAGATAGAGCAGATGGCTGATTCACTTGTTTCTAGAATGAGAAATCGCACTGGAAATCCAAA
TCCATAtatgacaatgtacctcaagaaatcaacagattacgatgccgtgtaaattatcatgctc
tcaaatttcttc
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence TATGACAATGTACCTCAAGAAATCAACAGATTACGATGCCGTGTAAATTATCATGCTCTCAAAT
TTCTTCCAGAGATAGAGCAGATGGCTGATTCACTTGTTTCTAGAATGAGAAATCGCACTGGAAA
TCCAAATCCATA
Conservation Information
Conserved circRNAs NA
PMCS 0.183928036
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017