Detail information of AT5G52440_circ_g.2


General Information
CircRNA Name AT5G52440_circ_g.2
ID in PlantcircBase ath_circ_043719
Alias NA
Organism Arabidpsis thaliana
Position chr5: 21287674-21287733  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method PcircRNA_finder
Parent gene AT5G52440
Parent gene annotation Sec-independent protein translocase protein TATB, chloroplastic
Parent gene strand +
Alternative splicing AT5G52440_circ_g.1
Support reads 2
Tissues leaf
Exon boundary   Yes-Yes
Splicing signals   GT-AG
Number of exons covered AT5G52440.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   ACATTTCAGCCAACGATTAGAGAGCTACAGgtagctcggaatcttggaaaaactctgcgt
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTAGCTCGGAATCTTGGAAAAACTCTGCGTACATTTCAGCCAACGATTAGAGAGCTACAG
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017