Detail information of 4_circ_igg.4


General Information
CircRNA Name 4_circ_igg.4
ID in PlantcircBase ath_circ_029858
Alias NA
Organism Arabidpsis thaliana
Position chr4: 2992569-2992619  JBrowse»
Reference genome TAIR10.38
Type   igg-circRNA
Identification method PcircRNA_finder
Parent gene NA
Parent gene annotation NA
Parent gene strand NA
Alternative splicing NA
Support reads 1
Tissues inflorescences, whole_plant
Exon boundary   No-No
Splicing signals   TT-CC
Number of exons covered NA
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TGTTTCTATAACCAGCTGATCCATTtttattcttgagtcttcatgtctaga
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence TTTATTCTTGAGTCTTCATGTCTAGATGTTTCTATAACCAGCTGATCCATT
Conservation Information
Conserved circRNAs NA
PMCS 0.153593467
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017