Detail information of AT5G19510_circ_g.3


General Information
CircRNA Name AT5G19510_circ_g.3
ID in PlantcircBase ath_circ_039245
Alias NA
Organism Arabidpsis thaliana
Position chr5: 6582351-6582409  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method CIRI, CIRI-full
Parent gene AT5G19510
Parent gene annotation Elongation factor 1-beta 2
Parent gene strand -
Alternative splicing AT5G19510_circ_g.1 AT5G19510_circ_g.2
Support reads 3
Tissues root
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered AT5G19510.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TCTCCTCTGCAGCTTTCTTTTCTTCTTCGgcttcttggtgtccttcttagcagcctccc
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 59
Transcript exons: 6582351-6582409
GCTTCTTGGTGTCCTTCTTAGCAGCCTCCCTCTCCTCTGCAGCTTTCTTTTCTTCTTCG

Genomic sequence GCTTCTTGGTGTCCTTCTTAGCAGCCTCCCTCTCCTCTGCAGCTTTCTTTTCTTCTTCG
Conservation Information
Conserved circRNAs NA
PMCS 0.37927043
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017