Detail information of AT3G25040_circ_g.3


General Information
CircRNA Name AT3G25040_circ_g.3
ID in PlantcircBase ath_circ_023711
Alias NA
Organism Arabidpsis thaliana
Position chr3: 9125267-9125386  JBrowse»
Reference genome TAIR10.38
Type   ei-circRNA
Identification method PcircRNA_finder
Parent gene AT3G25040
Parent gene annotation ER lumen protein-retaining receptor B
Parent gene strand +
Alternative splicing AT3G25040_circ_g.1 AT3G25040_circ_g.2
Support reads 1
Tissues seed
Exon boundary   No-Yes
Splicing signals   GT-TG
Number of exons covered AT3G25040.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CTTGTTGCAAAGGACTAGAAATATTGACAACTTGACCGGACAATATATATTTCTCCTTGGtcag
gtattgtggacgtcttcattgtacttggaggctgttgccatattacctcagcttgt
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence TCAGGTATTGTGGACGTCTTCATTGTACTTGGAGGCTGTTGCCATATTACCTCAGCTTGTCTTG
TTGCAAAGGACTAGAAATATTGACAACTTGACCGGACAATATATATTTCTCCTTGG
Conservation Information
Conserved circRNAs NA
PMCS 0.4066198
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017