Detail information of AT1G57770_circ_g.2


General Information
CircRNA Name AT1G57770_circ_g.2
ID in PlantcircBase ath_circ_007844
Alias NA
Organism Arabidpsis thaliana
Position chr1: 21397821-21397880  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method CIRI, CIRI-full
Parent gene AT1G57770
Parent gene annotation FAD/NAD(P)-binding oxidoreductase family protein
Parent gene strand +
Alternative splicing NA
Support reads 2
Tissues aerial
Exon boundary   Yes-No
Splicing signals   GT-AG
Number of exons covered AT1G57770.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   GGGCTAGGGTTCAAAAGAGAAAAGTGCGAGgtgatgtggagagcggttgagcgggcatta
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 60
Transcript exons: 21397821-21397880
GTGATGTGGAGAGCGGTTGAGCGGGCATTAGGGCTAGGGTTCAAAAGAGAAAAGTGCGAG

Genomic sequence GTGATGTGGAGAGCGGTTGAGCGGGCATTAGGGCTAGGGTTCAAAAGAGAAAAGTGCGAG
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017