Detail information of AT3G25470_circ_g.3


General Information
CircRNA Name AT3G25470_circ_g.3
ID in PlantcircBase ath_circ_023746
Alias NA
Organism Arabidpsis thaliana
Position chr3: 9234632-9234676  JBrowse»
Reference genome TAIR10.38
Type   e-circRNA
Identification method CIRCexplorer
Parent gene AT3G25470
Parent gene annotation Bacterial hemolysin-like protein
Parent gene strand +
Alternative splicing AT3G25470_circ_g.2
Support reads 1
Tissues root
Exon boundary   Yes-Yes
Splicing signals   GT-AG
Number of exons covered AT3G25470.1:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   AGATCCCGAAGTACATCAAGAGgtcgggaagggtggcatagtgag
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTCGGGAAGGGTGGCATAGTGAGAGATCCCGAAGTACATCAAGAG
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential Y
Potential coding position 9234671-9234634(-)
Potential amino acid sequence MYFGISHYATLPDLLMYFGISHYATLPDLLMYFGISHYATLPDLLMYFGISHYATLPD(-)
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017