Detail information of Os01g0711400_circ_g.1


General Information
CircRNA Name Os01g0711400_circ_g.1
ID in PlantcircBase osa_circ_040603
Alias NA
Organism Oryza sativa
Position chr1: 29563689-29563744  JBrowse»
Reference genome IRGSP-1.0.38
Type   e-circRNA
Identification method CIRI-long
Parent gene Os01g0711400
Parent gene annotation Similar to Victorin binding protein. (Os01t0711400-01)
Parent gene strand +
Alternative splicing Os01g0711400_circ_igg.1 Os01g0711400_circ_igg.2 Os01g0711400_circ_igg.3 Os01g0711400_circ_g.2 Os01g0711400_circ_g.3 Os01g0711400_circ_g.4 Os01g0711400_circ_g.5 Os01g0711400_circ_g.6 Os01g0711400_circ_g.7 Os01g0711400_circ_g.8
Support reads NA
Tissues leaf
Exon boundary   No-No
Splicing signals   GT-AG
Number of exons covered Os01t0711400-01:1
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   CAGGATAATTCATGAGAACGGTGGGCAGtctatgaagaaggcattgatgagatatg
Assembled circRNA sequence   Yes
Full-length trsnacripts Transcript length: 56
Transcript exons: 29563689-29563744
TCTATGAAGAAGGCATTGATGAGATATGCAGGATAATTCATGAGAACGGTGGGCAG

Genomic sequence TCTATGAAGAAGGCATTGATGAGATATGCAGGATAATTCATGAGAACGGTGGGCAG
Conservation Information
Conserved circRNAs NA
PMCS 0.386902679
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References this study