Detail information of AT5G45430_circ_g.2


General Information
CircRNA Name AT5G45430_circ_g.2
ID in PlantcircBase ath_circ_042542
Alias NA
Organism Arabidpsis thaliana
Position chr5: 18409382-18409425  JBrowse»
Reference genome TAIR10.38
Type   i-circRNA
Identification method CIRCexplorer
Parent gene AT5G45430
Parent gene annotation Protein kinase superfamily protein
Parent gene strand +
Alternative splicing NA
Support reads 1
Tissues root
Exon boundary   No-No
Splicing signals   TG-TT
Number of exons covered 0
Experimental Information
Sanger sequencing for BSS   NA
PCR primers for BSS    NA
Sanger sequencing for FL    NA
PCR primers for FL    NA
Sequences
Splice junction sequence   TAAAGACGTGTATAATGATTTGgtaagtatttttcattgagaga
Assembled circRNA sequence   NA
Full-length trsnacripts NA
Genomic sequence GTAAGTATTTTTCATTGAGAGATAAAGACGTGTATAATGATTTG
Conservation Information
Conserved circRNAs NA
PMCS 0.083333333
Functional Information
Coding potential N
Potential coding position NA
Potential amino acid sequence NA
Sponge-miRNAs NA
circRNA-miRNA-mRNA network  VISUALIZATION
Potential function description NA
Other Information
References Chu et al., 2017