logo




circRNA ID
osa_circ_000019
Alias
Os_ciR6595
Organism
Oryza sativa
Position
chr1: 75941-76109
Reference genome
RGAPv7
Type
exonic
Parent gene
Parent gene annotation
RNA recognition motif, putative, expressed
Strand
+
Splice junction sequence
AGCAAATTGTCGCCAACTCGTGACCATCATTCTTCTCGCCGTAGTAGGCGTTCTAGATCCAGAT
CTCAAGAGAAGAATCGCAACAcgacacagagaagaaagtttaagcccttcgaaatcacggaggt
cagctcgagctggttcaaggtcaccaggacagcacaaagga
Support reads
2
Tissues
root
Exon boundary
No-No
Splicing signals
AG-GT
Evidence 1: Sanger sequencing
NA
Evidence 1: PCR primers
NA
circRNA sequence
NA
Number of exons covered1
NA
Evidence 2: Sanger sequencing
NA
Evidence 2: PCR primers
NA
Genomic sequence
CGACACAGAGAAGAAAGTTTAAGCCCTTCGAAATCACGGAGGTCAGCTCGAGCTGGTTCAAGGT
CACCAGGACAGCACAAAGGAAGCAAATTGTCGCCAACTCGTGACCATCATTCTTCTCGCCGTAG
TAGGCGTTCTAGATCCAGATCTCAAGAGAAGAATCGCAACA
Number of exons covered2
LOC_Os01g01150.1:1
LOC_Os01g01150.2:1
LOC_Os01g01150.3:1
Conserved circRNAs
NA
Sponge-miRNA1
NA
Sponge-miRNA1-mRNA
NA
Sponge-miRNA2
NA
Sponge-miRNA2-mRNA
NA
Sponge-miRNA3
NA
Sponge-miRNA3-mRNA
NA
References
Ye et al., 2015

Copyright©2017 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
You are the visitor. Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn