logo




circRNA ID
osa_circ_000004
Alias
NA
Organism
Oryza sativa
Position
chr1: 27537-27572
Reference genome
RGAPv7
Type
exonic
Parent gene
Parent gene annotation
40S ribosomal protein S5, putative, expressed
Strand
+
Alternative splicing
NA
Splice junction sequence
CCGCATCGTCAAGCACGCcaagaagatcatggctgt
Support reads
2
Tissues
root
Exon boundary
No-No
Splicing signals
GG-CA
Evidence 1: Sanger sequencing
NA
Evidence 1: PCR primers
NA
circRNA sequence
NA
Number of exons covered1
NA
Evidence 2: Sanger sequencing
NA
Evidence 2: PCR primers
NA
Genomic sequence
CAAGAAGATCATGGCTGTCCGCATCGTCAAGCACGC
Number of exons covered2
LOC_Os01g01060.1:1
Conserved circRNAs
NA
Sponge-miRNA1
NA
Sponge-miRNA1-mRNA
NA
Sponge-miRNA2
NA
Sponge-miRNA2-mRNA
NA
Sponge-miRNA3
NA
Sponge-miRNA3-mRNA
NA
References
this study

Copyright©2017 Institute of Crop Sciences / Institute of Bioinformatics, Zhejiang University.
You are the visitor. Any questions or suggestions, please contact the Fan's lab, bioinplant@zju.edu.cn